diff --git a/modules/nf-core/crabs/insilicopcr/environment.yml b/modules/nf-core/crabs/insilicopcr/environment.yml
new file mode 100644
index 00000000000..c9761a2d14b
--- /dev/null
+++ b/modules/nf-core/crabs/insilicopcr/environment.yml
@@ -0,0 +1,5 @@
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - bioconda::crabs=1.0.7
diff --git a/modules/nf-core/crabs/insilicopcr/main.nf b/modules/nf-core/crabs/insilicopcr/main.nf
new file mode 100644
index 00000000000..ef1e9ffa20f
--- /dev/null
+++ b/modules/nf-core/crabs/insilicopcr/main.nf
@@ -0,0 +1,46 @@
+process CRABS_INSILICOPCR {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/crabs:1.0.7--pyhdfd78af_0':
+        'biocontainers/crabs:1.0.7--pyhdfd78af_0' }"
+
+    input:
+    tuple val(meta), path(fasta)
+
+    output:
+    tuple val(meta), path("*.{fa,fasta}"), emit: fasta
+    path "versions.yml"                  , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args    = task.ext.args ?: ''
+    def prefix  = task.ext.prefix ?: "${meta.id}"
+    """
+    crabs --in-silico-pcr \\
+        --input $fasta \\
+        --output ${prefix}.crabs.fa \\
+        --threads ${task.cpus} \\
+        $args
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        crabs: \$(crabs --help | grep 'CRABS |' | sed 's/.*CRABS | \\(v[0-9.]*\\).*/\\1/')
+    END_VERSIONS
+    """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.fa
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        crabs: \$(crabs --help | grep 'CRABS |' | sed 's/.*CRABS | \\(v[0-9.]*\\).*/\\1/')
+    END_VERSIONS
+    """
+}
diff --git a/modules/nf-core/crabs/insilicopcr/meta.yml b/modules/nf-core/crabs/insilicopcr/meta.yml
new file mode 100644
index 00000000000..3510f2f7b87
--- /dev/null
+++ b/modules/nf-core/crabs/insilicopcr/meta.yml
@@ -0,0 +1,52 @@
+name: crabs_insilicopcr
+description: CRABS extracts the amplicon region of the primer set by conducting an
+  in silico PCR.
+keywords:
+  - insilico
+  - PCR
+  - amplicon
+  - sequencing
+tools:
+  - crabs:
+      description: |
+        Crabs (Creating Reference databases for Amplicon-Based Sequencing)
+        is a program to download and curate reference databases
+        for eDNA metabarcoding analyses
+      homepage: https://github.com/gjeunen/reference_database_creator
+      documentation: https://github.com/gjeunen/reference_database_creator?tab=readme-ov-file#running-crabs
+      tool_dev_url: https://github.com/gjeunen/reference_database_creator
+      doi: 10.1111/1755-0998.13741
+      licence: ["MIT License"]
+      identifier: ""
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. `[ id:'sample1' ]`
+    - fasta:
+        type: file
+        description: Sequence to conduct in silico PCR on
+        pattern: "*.{fa,fasta}"
+output:
+  - fasta:
+      - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1' ]`
+      - "*.{fa,fasta}":
+          type: file
+          description: Reverse complemented amplified Sequence
+          pattern: "*.{fa,fasta}"
+  - versions:
+      - versions.yml:
+          type: file
+          description: File containing software versions
+          pattern: "versions.yml"
+authors:
+  - "@famosab"
+  - "@a4000"
+maintainers:
+  - "@famosab"
+  - "@a4000"
diff --git a/modules/nf-core/crabs/insilicopcr/tests/main.nf.test b/modules/nf-core/crabs/insilicopcr/tests/main.nf.test
new file mode 100644
index 00000000000..26b5b0ba93c
--- /dev/null
+++ b/modules/nf-core/crabs/insilicopcr/tests/main.nf.test
@@ -0,0 +1,71 @@
+nextflow_process {
+
+    name "Test Process CRABS_INSILICOPCR"
+    script "../main.nf"
+    process "CRABS_INSILICOPCR"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "crabs"
+    tag "crabs/insilicopcr"
+
+    test("sarscov2 - fasta") {
+
+        config "./nextflow.config"
+
+        when {
+            params {
+                module_args = '--forward "GTCGGTAAAACTCGTGCCAGC" --reverse "CATAGTGGGGTATCTAATCCCAGTTTG"'
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.modules_testdata_base_path +'genomics/sarscov2/genome/genome-ena.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.versions,
+                    file(process.out.fasta[0][1]).name,
+                    ).match()
+                }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fasta - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.modules_testdata_base_path +'genomics/sarscov2/genome/genome-ena.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out,
+                    path(process.out.versions[0]).yaml
+                    ).match() 
+                }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/crabs/insilicopcr/tests/main.nf.test.snap b/modules/nf-core/crabs/insilicopcr/tests/main.nf.test.snap
new file mode 100644
index 00000000000..8e7460f1058
--- /dev/null
+++ b/modules/nf-core/crabs/insilicopcr/tests/main.nf.test.snap
@@ -0,0 +1,53 @@
+{
+    "sarscov2 - fasta - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,adee442c0437fa5a481ff3e3b9760a44"
+                ],
+                "fasta": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,adee442c0437fa5a481ff3e3b9760a44"
+                ]
+            },
+            {
+                "CRABS_INSILICOPCR": {
+                    "crabs": "v1.0.7"
+                }
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.2",
+            "nextflow": "24.10.4"
+        },
+        "timestamp": "2025-02-03T14:34:58.943001"
+    },
+    "sarscov2 - fasta": {
+        "content": [
+            [
+                "versions.yml:md5,688cca24ee493f8c07e5e069e20fea10"
+            ],
+            "test.crabs.fa"
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-09-05T15:22:12.207826"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/crabs/insilicopcr/tests/nextflow.config b/modules/nf-core/crabs/insilicopcr/tests/nextflow.config
new file mode 100644
index 00000000000..9fdb9ed9351
--- /dev/null
+++ b/modules/nf-core/crabs/insilicopcr/tests/nextflow.config
@@ -0,0 +1,7 @@
+process {
+
+    withName: CRABS_INSILICOPCR {
+        ext.args = params.module_args
+    }
+
+}